pISSN 1225-7117 eISSN 2288-8268

Sequence of Alu PCR product (cox4 - clone49c)

Target Sequence
cox4 – clone 49c GGTTTTTGGGTTAACGGGACCTCTAGACTCGAGATCGAGTCGTCGGATCGGTTGCTGGAGAGATGG
TTCAGAGGTTAAGAGCTCCGAATGCTCTTCCAAAGGTCCTGAGTTCAATTCCCAGCAACCACAT
GGTGGCTCACAACCATCCCTTATGAGATCT
GGTGCCCTCTTCTGGTGTGCAGATATACATGGAAGCA
GAATGTTATATGCATAATAAATAAATTAAAATAAAAAAAAAAACCTCTTTACCTCCACTCTGAGAAACCT
AGCCTCTCAATTCAGATAGTTTCACTTAGTGATTATCAAAGAACGAAACACACAAGCATCACGTAAACT
GGTCATTTATTAGCATGGACCTTTGGACACAGCAGCTTCCTTCCAGCATGCTGAGAGGAGGGAACTGG
CAAGCAGTAAGGTCTTACTTCTTCCACTCGTTCTTGTCGTAGTCCCACTTGGCAGAGAAGCCCTGAATG
GGGTTGGCCTTCATGTCCAGCATCCTCTTGGTCTGCATGGCCACCCAGTCACGATCTAAGGTATGAGGG
ATG
GGGCCATACACTGTGGCGCAAAATGACTATGTGAGGCAGGGTGTCCTGCTGGGATGACACAGCCC
AAACCAAGCCACCTGCTTTAATCCAGGGCACTGAGATAATTCCTATCTCAGAACCATTCCTGGCTTATGA
AAGGTCAACAAGGAAGTCATTGAGTATTTAGCTAGACATCTTCCTTCCAATTGTCAGTGGCAGACTCTGC
AGGCTAGCCCAGCACACAGCCAGGGGGGTGCCACTCAGAGGGCTGGCACCTGTTACTAATTTGCAGCC
ACACTTACTAGGGGTGGGCCTACTAAGAATGCAGCATGACCTGACCCAGAGAGAATGCATGTCAGAGAG
CAGGCAAGCCCAACAATGTCCAAACAATATGAAAAAGGCCTAACACCCCAGACACCAGATGCCCAGGT
ACAGCCAGCCATGAAGCAAATGGGCCCCTCCTCACTCACAACACTATGCAATCTTCTGTCGCTTATTAAA
CAGATCCAGTGCTACTGAACATGGTGGGCTGTACGAAGCAAACTTATCTTGCCCTGCCCAAAGGATGGC
TGGCCATTCAAAAGGCAAGCTCTAGCTTATACCGGGTTCCCCTGATTACAGGTTTTCTATCCGCCCAAGG
CCTGGAGGCCTTGTGAAGCCCCCAAAAACCCAAAAAGACTAAAGTGGTTCGGGCCCCCCCTTTCCCCC
TTCCCTCTTTCACATGGGTCTTTCCCAAAATAAGAAAAAAAGGGGGGAAAAGCCGGGAAAAAAAAAA
AGGGCCTGGCC

The sequencing result includes clone 49c and CDS4 part of cox4 gene.

Gray-highlighted sequences indicate CDS4 sequences of cox4 and black-highlighted sequences indicate clone 49c and tail part.

Korean Society for Biotechnology and Bioengineering Journal 2022;37:17~24 https://doi.org/10.7841/ksbbj.2022.37.1.17
© Korean Society for Biotechnology and Bioengineering