pISSN 1225-7117 eISSN 2288-8268

Sequence of Alu PCR product (lane 8 and lane 17)

Target Sequence
Lane 8 (CTLA4Ig – Grepeat) ACCGGCCAATGTTTTTTGGTCTCTCTTGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTG
TGATGGATATCTGCAGAATTCGGCTTGTTCCTCGAGATCGAGTCGTCGGATCGGTTCTCCTATGCTCCCC
ACCTACTTTACCCATAAGTCTGTGCTTAGCGGTAA
ATAGTTTTCTCTTCCTGAGAAACTAGAGTGAGAAT
TTGTATGCCCTTTCTGTTTTCTCGGCATCTACCACCTCTTAAAACGCCAGGAGCTTTTGAGTTACCATAA
GTTCCCAACAGTCATATAAGCGGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTAGGAGGTCGCTGAGT
AGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCT
TAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGAC
TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAAC
TTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT
GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC
CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAGT
GGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTGCGTA
TTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGA
CTCACGGGGATTTCCAAGTCTCCACCCCATTGA
CGTCAATGGGAGTTTGTTTTGGCACCAAAATCAA
CGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGAGAATTCCGGAAGCCGAATTCCAGCACA
CTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTTGGCGTAATCATGGTCATAGCTGTTTC
CTGTGTGAAATTGTTTTCCGCTCACAATTCCACACAACATACGAACCCGGAAGCTTAAAGGGGAAAA
CCTGGGGGTGCCTAAAGGAGGGGGCTAACTCCCATTAATTGGCGTGGCCCCCCCTGCCCGCTTTTCC
CGTCGGGAAAACCTGGCTGGCCCCCTTCTTTTAATGAAATCCGCCCACCCCCCGGGGGGAAAGGGG
GGTTTGGGTATTTGGGGCGCCTTTTCCCTCTTCTCCCCCCCCCTAAACCTCCTGCCCCGGGGTGTGGG
GGGGGGGGAGGGGGGTATATTTCTCCTCTAAAGGGGAGTAAATGTTTTTCACAAATAAAGGGAGAA
AACCGAGAAAAAAAATGG
Lane 17 (GSR – clone 49c) CGAACAGAGCGCATTTAGTATTGTAGATCTCTTAGGGCGATTGGGCCCTCTAGATGCATGCTCGAGCGGC
CGCCAGTGTGATGGATATCTGCAGAATTCGGCTTGTTCCTCGAGATCGAGTCGTCGGATCGGTTCCAGA
AGAGGGCACCAGATCTCATTATGAATGGTTGTGAGCCATCATGTGGTTACTGGGAATTGAACTCAGGAC
CTCAGGAAGAGCAACCAGTGCTCTTAACCTCTGAGCCATCTCTCCATG
GTTTAGAGCACTTGTTAACTC
TTGCAGGGGACCCAAGTTCAATTCCCAGCACCCATATGGTGACTCAAAACTATCTGTAACTACAGTTCC
AGAGGATTTGATGCCTTCTGGCCTTCATTGGGGCAACCAGAAATGGCAGGGGAAAACCCCAACTCCA
CCTGGCGCAGGCAGCTGCAGGTTGTGCTAGGATTGCTCAGGTTGTGGCCATCTGAGCCATTTGAGAAC
CCGCATCTAGGTATTTATTTCTTAGAGAGGGCCAAGTTGAGGCAGGGGCCTTCTCAGCGACCTCCAAC
ACACAAGCAGGGAGCAGATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACC
ATAGGGGATCGGGAGATCTCCATAGAGCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCCCAATCC
TCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTCAGACAATGCGATGCA
ATTTCCTCATTTTATTAGGAGAGGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGGGGG
AGGGGCAAACAACAGATG
GAATTCCGGAAGCCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGAT
CCGAGCTCGGTACCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCAC
AATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACT
CACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAACTGCATTAATGA
ATCGGCCAACCCCCGGGGAGAGGCGGTTTGCTATTGGGGCCTCTTCCGCTTCTTCCCTCCTTGAATCCCT
TGGCCTCGGGGGTTCGGGTGGGGGAAGCGGTATCACTTCCCCCAAAGGCGGAATTGGGTTTCTCCCAA
AGGGGGGAAACCCGGAAAGAAATTTTGTACAAAGCGCCCAAAGGGACAAACCTAAAAGGCCGTTTTG
TGTTTTTAAGGTCCCCCCCCTAAAA

Gray-highlighted sequences indicate transgene part (CMV promoter and bGH pA tail each) and black-highlighted sequences indicate SINE sequence (G-repeat and clone 49c containing tail sequence each).

In case of lane 8, the only partial sequence of G-repeat was identified.

Korean Society for Biotechnology and Bioengineering Journal 2022;37:17~24 https://doi.org/10.7841/ksbbj.2022.37.1.17
© Korean Society for Biotechnology and Bioengineering