Korean Society for Biotechnology and Bioengineering Journal Korean Society for Biotechnology and Bioengineering Journal

pISSN 1225-7117 eISSN 2288-8268

Article

Home All Articles View

Research Paper

Korean Society for Biotechnology and Bioengineering Journal 2022; 37(1): 17-24

Published online March 31, 2022 https://doi.org/10.7841/ksbbj.2022.37.1.17

Copyright © Korean Society for Biotechnology and Bioengineering.

재조합 CHO 세포주의 DNA 반복서열을 활용한 PCR 기반 외래유전자 삽입위치 분석

PCR-based Analysis of Transgene Integration Sites using DNA Repeat Sequences of Recombinant CHO Cells

Sang Yeop Lee and Jong Youn Baik*

Department of Biological Sciences and Bioengineering, Inha University, Incheon 22212, Korea

Correspondence to:Tel: +82-32-860-7513; Fax: +82-32-872-4046
E-mail: jybaik@inha.ac.kr

Received: December 28, 2021; Revised: February 27, 2022; Accepted: March 14, 2022

Chinese hamster ovary (CHO) cells have been used for the production of therapeutic recombinant proteins, including monoclonal antibodies. CHO cell lines producing recombinant protein are developed traditionally by random integration, leading to clonal variation issues, arbitrarily various phenotypic characteristics between clones. Thus, development of inexpensive and fast strategy for transgene integration site analysis is necessary. In this study, we optimized Alu polymerase chain reaction (Alu PCR) for CHO cells using short interspersed nuclear elements (SINEs) in the genome. Uracilcontaining primers were used to specifically amplify the target between SINE and recombinant protein coding transgene. We applied this strategy to identify transgene integration site as well as the endogenous housekeeping gene as a control. In conclusion, we verify that Alu PCR can be an inexpensive and rapid alternative analysis tool to detect integration sites.

Keywords: Chinese hamster ovary (CHO), short interspersed nuclear elements (SINEs), Alu PCR, cell line development, transgene integration site

Chinese hamster ovary (CHO) 세포를 이용하여 생산된 재조합 단백질의약품은 전 세계 바이오의약품 시장에서 현재까지 큰 주목을 받아오고 있다 [1]. CHO 세포에서 생산된 단백질은 인간의 체내에서 합성되는 단백질과 유사한 N-glycosylation 및 접힘이 일어나 분자적 구조가 유사하여 투여 시 면역반응을 일으킬 위험성이 낮다 [2]. 또한 재조합 CHO 세포주의 개발이 다른 동물세포에 비해 쉽고 대규모 배양공정에 적용하기 용이하여 전체 항체치료제 생산의 60%에 활용되었다 [1]. 최근에는 COVID-19 치료에도 활용되어 CHO 세포를 이용한 단백질의약품 시장의 성장은 당분간 지속될 것으로 전망된다 [3].

재조합 단백질의약품이 각광을 받음에 따라 의약품을 생산하는 재조합 CHO 세포주를 개발하는 기술의 중요성도 강조되어 왔다. 과거부터 주로 이용되고 있는 세포주 개발 전략인 random integration은 단백질의약품을 암호화하는 유전자를 숙주 세포의 핵 내로 주입하여 무작위로 삽입되는 현상을 이용한 전략이다. 이후에 dihydrofolate reductase (DHFR)/ methotrexate (MTX) system 혹은 glutamine synthetase (GS)/ methionine sulfoximine (MSX) system을 활용할 경우 최초 삽입된 외래유전자의 주위에 amplicon이 형성되어 세포주의 단백질 생산성을 증가시킬 수 있다 [2]. 그러나, random integration 및 유전자 증폭 과정에서 삽입되는 유전자의 위치 및 copy number의 차이로 인해 각 clone 마다 생장 경향, 생산성, 품질이 서로 상이한 clonal variation을 보인다. 이러한 이유로 FDA에서는 바이오의약품의 사용 허가를 위하여 생산 세포주의 clonality 검증을 엄격히 요구하고 있으며 [4] fluorescence in situ hybridization (FISH), 혹은 whole genome sequencing 등의 방법으로 삽입된 유전자의 위치를 규명하는 전략이 근본적인 clonality 검증 전략이 될 수 있다. 하지만 이러한 분석법은 분석 당 $1,000 이상의 높은 분석 비용과 1개월 이상의 기간을 요구하는 단점이 존재한다. 따라서 분석 비용 및 기간을 단축한 새로운 외래유전자 삽입위치 분석 기술의 개발이 필요하다.

Random integration으로 삽입된 유전자의 위치를 파악하기 위해 CHO 세포의 유전체적 특징을 이해하여야 한다. CHO 세포는 Chinese hamster (Cricetulus griseus)의 난소에서 유래된 세포로, Chinese hamster의 유전체에서 발견되는 특징이 CHO 세포의 유전체에서도 확인된다. 대표적인 사례로 Chinese hamster의 유전체 내의 retrotransposon이 CHO 세포의 유전체에서도 다수 확인된 바 있다 [5-7]. Retrotransposon은 유전체 상에서 위치를 이동할 수 있는 transposable elements로 크기와 구성에 따라 다양하게 분류된다. 이 중에서 Short interspersed nuclear elements (SINEs)은 평균 100-300 bp의 비교적 짧은 길이를 가지며 종류에 따라 다른 빈도로 반복된다. SINEs는 Long interspersed nuclear elements (LINEs)에 의해 발현된 역전사효소에 의해 복제되거나 역전사되어 위치를 이동할 수 있다 [8]. CHO 세포에서 확인된 SINE으로 인간에서도 확인되는 Alu family, 설치류에서 확인되는 B family, 그리고 G-repeat 등이 알려져 있다 [5-7].

본 연구에서는 유전체 내에 존재하는 SINEs를 활용하여 외래유전자의 위치를 파악하는 Alu polymerase chain reaction(Alu PCR)을 CHO 세포에 맞게 최적화하였다. Alu PCR은 uracil이 포함된 customized arm-attached primer를 사용하는 PCR로, 총 3 단계의 과정을 거치며 SINE과 외래유전자 사이의 구간을 특이적으로 증폭한다 (Fig. 1). 이번 연구에서는 다양한 SINEs 중 유전체 내에서 30,000 - 300,000 회 반복되는 SINE 세 종을 선정하였고 (Table 1), SINE 염기서열의 구조적 특징 중 각 SINE의 고유한 특이성을 보이는 서열을 선정하여 특수 primer를 사용한 실험을 구상하였다 (Fig. 2). SINE의 근처에 존재하는 housekeeping gene인 cytochrome coxidase 4 (cox4) 유전자를 활용하여 Alu PCR 실험 조건을 최적화하였으며 세 종류의 세포주에 Alu PCR을 적용하여 두 종류의 세포주에 삽입된 각각의 외래유전자의 위치를 파악하는데 성공하였다.

Table 1 SINE types used in Alu PCR

SINEsAbbreviationFrequency (repeats)NCBI accession number
Chinese hamster Alu-equivalent type 2 repeat (clone 49c)clone 49c> 300,000J00056.1
Mouse B1 ubiquitous repeatB1> 300,000J00631.1
Chinese hamster consensus G-repeatG-repeat30,000~50,000X15416.1


Figure 1. The whole processes of Alu PCR. Black one-head arrows indicate primers. The loci between transgene and SINEs are amplified in the first PCR. Uracil-containing customized tail (dotted line) is attached to the primers which are complementary with SINEs (dotted line-attached black arrow). Transgene-complementary primer is added 9-fold more than SINE-complementary primer (total 10-fold higher). After the first PCR, UDG is added for removing uracil on tail and forming apurinic sites and then heated for detaching short fragments caused by UDG. In the second PCR, the nested primer of transgene and tail-complementary primer are used. 10 cycles of touchdown PCR and 30 cycles of normal PCR are carried out continuously. There are four possibilities after 1 cycle of touchdown PCR and only target-containing product is amplified (dotted box)

Figure 2. Structures of SINEs used in Alu PCR. One-head arrows indicate SINE-specific primers. (a) Clone 49c of CHO Alu equivalent sequence (b) Mouse B1 sequence of B family (c) Grepeat.

2.1. 재조합 CHO 세포주의 genomic DNA 추출

Random integration으로 개발된 세포주로 Rituximab을 생산하는 rCHO-K1 세포주 (GSR), human albumin-erythropoietin(Alb-EPO)을 생산하는 rCHO-DXB11 세포주, human cytotoxic T lymphocyte antigen 4 - immunoglobulin (CTLA4Ig)을 생산하는 rCHO-DXB11 세포주를 사용하였다. GSR 세포주는 이균민 교수 연구실에서, Alb-EPO와 CTLA4Ig 세포주는 김동일 교수 연구실에서 각각 기증받았다. 각 세포주의 배양용 배지로 GSR의 배양에는 PowerCHOTM 2 Serum-free Medium(Lonza, Basel, Switzerland), Alb-EPO와 CTLA4Ig의 배양에는 Pr°CHO5 (Lonza, Basel, Switzerland)를 사용하였다. Alb-EPO와 CTLA4Ig의 배양에는 6 mM의 L-glutamine (Sigma-Aldrich, St. Louis, MO, US)가 별도로 첨가되었으며, GSR의 배양에는 0.4 mL의 GSEM (Sigma-Aldrich, St. Louis, MO, US)이 추가로 첨가되었다. 125 mL Erlenmeyer flask에 각 세포주에 최적화된 배지를 각각 20 mL로 맞추어 세포의 초기농도를 3 × 105 cells/mL 이 되도록 접종하였다. 접종된 flask의 진탕배양 (suspension culture)은 humidified CO2 incubator(Sanyo Electric, Osaka, Japan)에서 5% CO2, 37 ℃ 조건을 유지하며 orbital shaker에서 110 rpm으로 진행되었다. 계대배양은 3일 간격으로 3회 실시하였으며, 계대배양 이후의 세포농도는 모두 3 × 105 cells/mL로 통일하였다. 계대배양을 3회 수행한 수 3일차에 세포를 각각 107cells 씩 회수하고 AccuPrep® Genomic DNA Extrraction Kit (Bioneer, Daejeon, Korea)를 사용하여 각 세포주의 genomic DNA를 추출하였다.

2.2. Primer 디자인

본 연구에 활용하는 SINE으로 CHO Alu-equivalent sequence 중 clone 49c (clone 49c), mouse B family sequence 중 B1, 그리고 G-repeat을 활용하였다. SINE과 결합하는 primer의 경우 각 SINE의 RNA pol III promoter와 결합할 수 있도록 데이터베이스 (https://sines.eimb.ru/Help.html.)를 참조하여 목표위치를 선정하였다. Alu PCR의 첫 번째 PCR에서 사용할 primer를 구상하는 단계에서, 각 SINE 별로 방향성을 고려하여 서로 반대 방향의 primer 쌍을 구상하였으며, 각 5’ 말단에는 thymine 대신 uracil을 일부 포함하면서 CHO 세포의 유전체에 존재하지 않는 임의의 서열인 tail (ATC GAG TCG UCG GAT CGG TU)을 부착하였다. 외래유전자에 결합하는 primer는 세 종류 세포주의 외래유전자에 공통으로 존재하는 cytomegalovirus (CMV) promoter, bovine growth hormone(bGH) poly A tail에 상보적인 서열로 구상하였다. Alu PCR의 두 번째 PCR에서는 SINE의 tail에 결합하는 primer, 첫 번째 PCR 결과물의 외래유전자 부위 중 내부에 결합하는 nested primer를 각각 구상하였다 (Table 2).

Table 2 Primers designed for Alu PCR

Primer NameTarget locusUsageSequence (5` → 3`)
COX4 1st FPCOX4First PCRGGA GTG TTG TGA AGA GTG AAG ACT
EcoRI/COX4 2nd FPSecond PCRCCG GAA TTC GTC TTC CTG CTT ATA TGG ATC GGC
CMV Promoter 1st RPTransgeneFirst PCRATA GAC CTC CCA CCG TAC AC
bGH pA Tail 1st FPTGT GCC TTC TAG TTG CCA GC
EcoRI/CMV Promoter 2nd RPSecond PCRCCG GAA TTC TCA ATG GGG CGG AGT TGT TAC
EcoRI/bGH pA Tail 2nd FPCCG GAA TTC CAT CTG TTG TTT GCC CCT CC
Tailed clone 49c FPSINEsFirst PCRATC GAG TCG UCG GAT CGG TUG CTG GAG AGA TGG TTC AGA GGT
Tailed clone 49c RPATC GAG TCG UCG GAT CGG TUC CAG AAG AGG GCA CCA GAT CT
Tailed mouse B1 FPATC GAG TCG UCG GAT CGG TUT GGT GGC GCA CAC CTT TAA TC
Tailed mouse B1 RPATC GAG TCG UCG GAT CGG TUT CTT TGT GTA GCC TTG GCT GT
Tailed G-repeat FPATC GAG TCG UCG GAT CGG TUC TCC TAT GCT CCC CAC CTA C
Tailed G-repeat RPATC GAG TCG UCG GAT CGG TUC CTT GGA GCC AGT GTT TAT CCC
XhoI/TailCustomized tailSecond PCRGTT CCT CGA GAT CGA GTC GTC GGA TCG GTT

The whole primers for second PCR have restriction enzyme digestion sites to apply Alu PCR in case of DNA cloning without TA cloning steps.

FP : forward primer, RP : reverse primer



2.3. Alu PCR

첫 번째 PCR 과정에서는 시료당 100 ng의 genomic DNA, 200 μM의 dNTP (New England Biolabs, Ipswich, MA, US)와함께 외래유전자에 상보적인 primer를 100 μM, SINE에 상보적인 primer를 10 μM가 되도록 첨가하여 총 25 μL의 부피로 통일하였다. PCR 과정은 T100TM Thermal Cycler (Bio-Rad, Hercules, CA, US)을 이용하여 94°C에서 30초의 denaturation, 60°C에서 30초의 primer annealing, 68°C에서 4분의 extension 과정을 총 30회 진행하였다. 최초의 PCR을 완료한 시료에 Uracil DNA glycosylase (UDG) (New England Biolabs, Ipswich, MA, US) 5 unit과 DNase-free water를 추가로 첨가하여 총 30 μL의 시료를 준비하였으며 37°C에서 30분, 94°C에서 10분 처리하여 tail에 부착된 Uracil의 잔기를 제거하였다. UDG에 의한 잔기 제거 과정 이후의 시료를 DNase-free water에 1000배로 희석한 후 1 μL를 취하여 두 번째 PCR의 주형으로 사용하였으며 tail에 상보적인 primer와 외래유전자의 nested primer를 모두 10 μM가 되도록 첨가하였다. Primer를 제외한 PCR 혼합물은 이전 단계의 PCR 혼합물과 동일한 조건으로 첨가되었다. 두 번째 PCR은 annealing 시 온도가 매 회차마다 1°C씩 감소하는 touchdown PCR을 접목하여 94°C에서 30초의 denaturation, 65°C에서 30초의 primer annealing, 68°C에서 4분의 extension 과정을 10회 진행하였다. 이 과정에서 annealing 시 온도는 65°C로 시작하여 56°C까지 도달했으며, 이후에는 55°C의 일정한 온도로 30회의 PCR을 중단없이 진행하였다 (Fig. 1). Alu PCR의 모든 과정을 진행한 후 시료들은 Dyne LoadingSTAR (Dyne Bio, Seoungnam, Korea)으로 염색하여 1% (w/v) agarose gel 상에서 100 V의 전압이 흐르는 TAE buffer 내에서 25분 동안 전기영동을 수행하였고 Gel Doc XR+ Gel Documentation System (Bio-Rad, Hercules, CA, US)를 통하여 결과를 확인하였다.

2.4. DNA cloning

Alu PCR의 결과로 추정되는 PCR product는 agarose gel extraction의 방법으로 Universal DNA Purification Kit (Tiangen, Beijing, China)를 사용하여 확보하였다. 이후 TA Cloning™ Kit with pCR™2.1 Vector(Invitrogen, Waltham, MA, US)를 사용하여 재조합 plasmid를 제작하였다.

2.5. DNA 염기서열 분석 및 외래유전자 삽입위치 확인

Escherichia coli 중 XL-1 blue의 야생형 균주를 이용하여 제작된 competent cell에 DNA cloning 결과 생성된 재조합 plasmid를 첨가하여 30분 ice에서 0°C를 유지하였다. 42°C 조건에서 1분 동안 incubation을 진행한 다음 다시 5분 ice에서 0°C를 유지하였다. 1 mL의 liquid LB broth medium을 첨가하여 shaking incubator (Vision scientific, Daejeon, Korea)에서 37°C, 200 rpm 조건으로 1시간 배양을 진행하였고 50 μg/mL의 X-gal, 100 μg/mL의 IPTG, 50 μg/mL의 kanamycin이 첨가된 LB agar plate에 spreading하여 16시간 배양하였다. 배양결과 확인되는 white colony를 취하여 50 μg/mL의 kanamycin이 포함된 liquid LB broth 5 mL에 최초 접종하여 37°C, 200 rpm 조건에서 16시간 배양을 진행하였으며 FavorPrepTM Plasmid Extraction Mini Kit (Favorgen, Ping-Tung, Taiwan)을 사용하여 재조합 plasmid를 확보하였다. Plasmid의 DNA 염기서열 분석에는 BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Waltham, MA, US)와 3730xl DNA Analyzer (Applied Biosystems, Waltham, MA, US)가 사용되었다. 분석된 DNA 염기서열을 NCBI의 BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi.) 기능을 사용하여 Chinese hamster의 유전체 상에서의 상동성을 비교하여 최종적인 삽입위치를 확인하였다.

3.1. Alu PCR을 적용할 SINE 선정

CHO 세포의 모체인 Chinese hamster의 유전체에는 다양한 SINE이 존재한다는 사실이 알려져 있으며 본 연구에서 사용한 세 가지 유형의 SINE도 이에 포함된다 [5-7]. 그러나 CHO 세포는 aneuploidy 형태의 불안정한 유전체 구조를 지닐뿐 아니라, 거의 완벽한 유전체 염기 서열을 바탕으로 SINE의 연구가 많이 진행되어 있는 human, mouse 등의 모델 개체와 달리 유전체 조립의 품질이 매우 낮아 scaffold 수준의 Reference 유전체 조립에 머물러 있다. 이러한 이유로 CHO 유전체에서는 SINE의 정확한 분포나 빈도를 파악하기 어려우므로, 본 연구에서는 유전체 상에서 SINE이 다른 모델 개체와 비슷한 양상으로 존재할 것임을 가정하고 반복 횟수와 유전체 크기를 고려하여 실험을 구상하였다. 따라서 각 서열들은 약 30,000~300,000 회 반복되는 서열들로 CHO 세포 유전체의 크기가 2.3 Gbp임을 감안할 때 G-repeat은 약 76 kb마다, clone 49c와 B1은 이론적으로 약 7.6 kb 마다 반복된다고 가정하였다 (Table 1). 또한 SINE의 구조적 특징인 RNA pol III promoter와 poly A tail 등의 구조가 명확하고 각 SINE의 고유한 서열도 특이성을 가져 Alu PCR에 적용하기에 적합한 SINE이라 판단하였다 (Fig. 2). Alu PCR에서 SINE에 결합하는 primer는 각 SINE의 고유한 서열을 띠는 부위에서 구상하였다.

3.2. Alu PCR의 실험 조건 최적화

외래유전자의 위치를 Alu PCR로 분석하기에 앞서 본 연구에서는 control gene인 cox4를 활용하여 Alu PCR의 protocol을 최적화하였다. cox4는 Chinese hamster의 chromosome 3에 존재하는 housekeeping gene으로 clone 49c로부터 135 bp, B1으로부터 645 bp 떨어진 위치에 존재하며 cox4 내의 coding sequence 2를 목표 위치로 선정할 경우 2,096 bp의 Alu PCR product가 생성될 것으로 예상하였다 (Fig. 3(a)). 기존의 Alu PCR의 첫 번째 PCR 과정에서 10 cycles를 진행했던 조건과 달리 본 연구에서는 SINE과 외래유전자 사이 구간의 충분한 증폭을 위해 첫 번째 PCR을 30 cycles를 진행하였으며, UDG에 의한 uracil digestion 단계까지 마무리한 intermediate product는 1000배 희석되어 두 번째 PCR에 사용되었다 (Fig. 1(c)) [9]. 또한 SINE에 결합하는 primer 중 CHO 세포의 유전체 상에 존재하지 않는 임의의 서열인 tail에 thymine 대신 모두 uracil이 사용되었던 기존 연구와 달리 본 연구에서는 uracil과 thymine을 조합하여 분석 당 비용을 절감 효과를 극대화하였다.

Figure 3. Alu PCR applied to an endogenous gene. (a) Cytochrome c oxidase subunit 4 (cox4) is 135 bp away from clone 49c. The product size between primers on coding sequence 2 and clone 49c was expected to be 2.1 kb. (b) Results of Alu PCR between cox4 and clone 49c. Thirty cycles of normal PCR were performed using primer pairs for the first PCR step of Alu PCR. CHO-K1 and GSR were used to validate experiment. 2.1 kb of results were identified in only Alu PCR result.

Alu PCR과 함께 일반적인 PCR을 30 cycles를 각각 수행한 결과 일반적인 30 cycles의 PCR에서는 확인되지 않는 2.1 kb band가 GSR과 숙주세포인 CHO-K1에서 모두 확인되었다(Fig. 3(b)). 일반적인 PCR은 COX4 1st FP (GGA GTG TTG TGA AGA GTG AAG ACT)와 Tailed clone 49c (ATC GAG TCG UCG GAT CGG TUG CTG GAG AGA TGG TTC AGA GGT)를 primer로 사용하여 Alu PCR의 첫 번째 PCR 과정을 30회 진행하였으며 이외의 PCR 조건은 모두 동일하게 진행되었다. 2.1 kb band를 agarose gel 상에서 추출하여 전체 2,096 bp 중 1,138 bp 구간의 DNA 염기서열 분석을 진행한 결과 clone 49c와 cox4의 coding sequence 4를 포함한 intron까지 염기서열이 일치함을 확인하였다 (Table 3). 본 실험을 통해 SINE과 목적유전자 사이의 특이적인 증폭을 Alu PCR을 활용하여 유도할 수 있음을 확인하였다.

Table 3 Sequence of Alu PCR product (cox4 - clone49c)

TargetSequence
cox4 – clone 49cGGTTTTTGGGTTAACGGGACCTCTAGACTCGAGATCGAGTCGTCGGATCGGTTGCTGGAGAGATGG
TTCAGAGGTTAAGAGCTCCGAATGCTCTTCCAAAGGTCCTGAGTTCAATTCCCAGCAACCACAT
GGTGGCTCACAACCATCCCTTATGAGATCT
GGTGCCCTCTTCTGGTGTGCAGATATACATGGAAGCA
GAATGTTATATGCATAATAAATAAATTAAAATAAAAAAAAAAACCTCTTTACCTCCACTCTGAGAAACCT
AGCCTCTCAATTCAGATAGTTTCACTTAGTGATTATCAAAGAACGAAACACACAAGCATCACGTAAACT
GGTCATTTATTAGCATGGACCTTTGGACACAGCAGCTTCCTTCCAGCATGCTGAGAGGAGGGAACTGG
CAAGCAGTAAGGTCTTACTTCTTCCACTCGTTCTTGTCGTAGTCCCACTTGGCAGAGAAGCCCTGAATG
GGGTTGGCCTTCATGTCCAGCATCCTCTTGGTCTGCATGGCCACCCAGTCACGATCTAAGGTATGAGGG
ATG
GGGCCATACACTGTGGCGCAAAATGACTATGTGAGGCAGGGTGTCCTGCTGGGATGACACAGCCC
AAACCAAGCCACCTGCTTTAATCCAGGGCACTGAGATAATTCCTATCTCAGAACCATTCCTGGCTTATGA
AAGGTCAACAAGGAAGTCATTGAGTATTTAGCTAGACATCTTCCTTCCAATTGTCAGTGGCAGACTCTGC
AGGCTAGCCCAGCACACAGCCAGGGGGGTGCCACTCAGAGGGCTGGCACCTGTTACTAATTTGCAGCC
ACACTTACTAGGGGTGGGCCTACTAAGAATGCAGCATGACCTGACCCAGAGAGAATGCATGTCAGAGAG
CAGGCAAGCCCAACAATGTCCAAACAATATGAAAAAGGCCTAACACCCCAGACACCAGATGCCCAGGT
ACAGCCAGCCATGAAGCAAATGGGCCCCTCCTCACTCACAACACTATGCAATCTTCTGTCGCTTATTAAA
CAGATCCAGTGCTACTGAACATGGTGGGCTGTACGAAGCAAACTTATCTTGCCCTGCCCAAAGGATGGC
TGGCCATTCAAAAGGCAAGCTCTAGCTTATACCGGGTTCCCCTGATTACAGGTTTTCTATCCGCCCAAGG
CCTGGAGGCCTTGTGAAGCCCCCAAAAACCCAAAAAGACTAAAGTGGTTCGGGCCCCCCCTTTCCCCC
TTCCCTCTTTCACATGGGTCTTTCCCAAAATAAGAAAAAAAGGGGGGAAAAGCCGGGAAAAAAAAAA
AGGGCCTGGCC

The sequencing result includes clone 49c and CDS4 part of cox4 gene.

Gray-highlighted sequences indicate CDS4 sequences of cox4 and black-highlighted sequences indicate clone 49c and tail part.



3.3. Alu PCR을 활용한 외래유전자의 삽입위치 확인

바이오의약품 생산 세포주를 이용한 외래유전자의 삽입위치 확인은 SINE의 위치에 따라 두 가지의 경우로 나누어 실험을 진행하였다. 실험에 사용한 rCHO의 야생형은 CHODXB11, CHO-K1 총 두 종류였으나 본 실험에서는 DHFR 유전자의 유무 이외에 두 야생형의 유전적 차이가 없음을 감안하여 모든 sample의 대조군으로 CHO-K1을 사용하였다. Alu PCR의 결과물은 대조군인 CHO-K1에서는 확인되지 않으면서 크기가 약 0.8 kb 이상일 때 추가 분석을 시도하였는데, 그 이유는 결과물이 Alu PCR을 통해 증폭되는 transgene의 크기(promoter 부분과 poly A 부분 각각 약 0.5 kb)와 SINE의 크기(각 SINE 별 약 0.3 kb)의 합인 0.8 kb를 포함해야 하기 때문이다. SINE이 외래유전자 앞에 존재한다는 첫 번째 가정에서는 외래유전자의 CMV promoter와 세 종류 SINE의 forward primer, reverse primer가 사용되었으며 target product로 예상되는 band가 CTLA4Ig에서 G-repeat을 활용한 lane 8에서 확인되었다 (Fig. 4(a)). Lane 8의 경우 1 kb 부근의 band를 추출하여 DNA 염기서열 분석을 진행한 결과 CTLA4Ig를 암호화하는 외래유전자가 chromosome 8에 존재하는 plekstrin homology domain containing A5 (plekha5)의 intron에 삽입된 것을 확인하였다 (NC_048601.1) (Fig. 4(b), Table 4). Alb-EPO의 결과에서 lane 1이 Alu PCR 최소 크기 조건에 충족하지는 않았으나 CHO-K1과 달리 선명한 band가 관찰되어 분석을 진행하였고 그 결과 CMV promoter의 짧은 단편만이 확인되어 target product가 아님을 확인하였다. SINE이 외래유전자의 뒤에 존재하는 두 번째 가정에서는 bGH poly A tail과 SINE이 Alu PCR에 활용되었으며 GSR에서 clone 49c를 활용한 lane 17에서 약 1 kb의 band가 확인되었다 (Fig. 4(c)). 해당band를 추출하여 염기서열을 분석한 결과 Rituximab을 암호화하는 외래유전자가 chromosome 5의 intron of tetratricopeptide repeat protein 7a (Ttc7a)에 삽입된 것을 확인하였다 (NC_048598.1) (Fig. 4(d), Table 4).

Table 4 Sequence of Alu PCR product (lane 8 and lane 17)

TargetSequence
Lane 8 (CTLA4Ig – Grepeat)ACCGGCCAATGTTTTTTGGTCTCTCTTGGGCGATTGGGCCTCTAGATGCATGCTCGAGCGGCCGCCAGTG
TGATGGATATCTGCAGAATTCGGCTTGTTCCTCGAGATCGAGTCGTCGGATCGGTTCTCCTATGCTCCCC
ACCTACTTTACCCATAAGTCTGTGCTTAGCGGTAA
ATAGTTTTCTCTTCCTGAGAAACTAGAGTGAGAAT
TTGTATGCCCTTTCTGTTTTCTCGGCATCTACCACCTCTTAAAACGCCAGGAGCTTTTGAGTTACCATAA
GTTCCCAACAGTCATATAAGCGGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTAGGAGGTCGCTGAGT
AGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCT
TAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGAC
TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAAC
TTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTAT
GTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC
CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAGT
GGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTGCGTA
TTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGA
CTCACGGGGATTTCCAAGTCTCCACCCCATTGA
CGTCAATGGGAGTTTGTTTTGGCACCAAAATCAA
CGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGAGAATTCCGGAAGCCGAATTCCAGCACA
CTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTTGGCGTAATCATGGTCATAGCTGTTTC
CTGTGTGAAATTGTTTTCCGCTCACAATTCCACACAACATACGAACCCGGAAGCTTAAAGGGGAAAA
CCTGGGGGTGCCTAAAGGAGGGGGCTAACTCCCATTAATTGGCGTGGCCCCCCCTGCCCGCTTTTCC
CGTCGGGAAAACCTGGCTGGCCCCCTTCTTTTAATGAAATCCGCCCACCCCCCGGGGGGAAAGGGG
GGTTTGGGTATTTGGGGCGCCTTTTCCCTCTTCTCCCCCCCCCTAAACCTCCTGCCCCGGGGTGTGGG
GGGGGGGGAGGGGGGTATATTTCTCCTCTAAAGGGGAGTAAATGTTTTTCACAAATAAAGGGAGAA
AACCGAGAAAAAAAATGG
Lane 17 (GSR – clone 49c)CGAACAGAGCGCATTTAGTATTGTAGATCTCTTAGGGCGATTGGGCCCTCTAGATGCATGCTCGAGCGGC
CGCCAGTGTGATGGATATCTGCAGAATTCGGCTTGTTCCTCGAGATCGAGTCGTCGGATCGGTTCCAGA
AGAGGGCACCAGATCTCATTATGAATGGTTGTGAGCCATCATGTGGTTACTGGGAATTGAACTCAGGAC
CTCAGGAAGAGCAACCAGTGCTCTTAACCTCTGAGCCATCTCTCCATG
GTTTAGAGCACTTGTTAACTC
TTGCAGGGGACCCAAGTTCAATTCCCAGCACCCATATGGTGACTCAAAACTATCTGTAACTACAGTTCC
AGAGGATTTGATGCCTTCTGGCCTTCATTGGGGCAACCAGAAATGGCAGGGGAAAACCCCAACTCCA
CCTGGCGCAGGCAGCTGCAGGTTGTGCTAGGATTGCTCAGGTTGTGGCCATCTGAGCCATTTGAGAAC
CCGCATCTAGGTATTTATTTCTTAGAGAGGGCCAAGTTGAGGCAGGGGCCTTCTCAGCGACCTCCAAC
ACACAAGCAGGGAGCAGATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACC
ATAGGGGATCGGGAGATCTCCATAGAGCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCCCAATCC
TCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTCAGACAATGCGATGCA
ATTTCCTCATTTTATTAGGAGAGGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGGGGG
AGGGGCAAACAACAGATG
GAATTCCGGAAGCCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGAT
CCGAGCTCGGTACCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCAC
AATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACT
CACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAACTGCATTAATGA
ATCGGCCAACCCCCGGGGAGAGGCGGTTTGCTATTGGGGCCTCTTCCGCTTCTTCCCTCCTTGAATCCCT
TGGCCTCGGGGGTTCGGGTGGGGGAAGCGGTATCACTTCCCCCAAAGGCGGAATTGGGTTTCTCCCAA
AGGGGGGAAACCCGGAAAGAAATTTTGTACAAAGCGCCCAAAGGGACAAACCTAAAAGGCCGTTTTG
TGTTTTTAAGGTCCCCCCCCTAAAA

Gray-highlighted sequences indicate transgene part (CMV promoter and bGH pA tail each) and black-highlighted sequences indicate SINE sequence (G-repeat and clone 49c containing tail sequence each).

In case of lane 8, the only partial sequence of G-repeat was identified.



Figure 4. Alu PCR results applying to recombinant cell lines. (a) The FP of each SINEs and CMV promoter of each SINEs were used to detect integration site on genome of two cell lines (Alb-EPO and CTLA4Ig). Two remarkable results (lane 1 and lane 8) were identified. Unlike two results, no results identified on GSR (data now shown). (b) Transgene integration site of CTLA4Ig analyzed using the result of lane 8. Transgene was inserted in intron between exon 23 and 24 of plekstrin homology domain containing A5 (plekha5) gene of chromosome 8. Black one-head arrows indicate primers for Alu PCR. (c) The FP and RP of each SINEs and bGH poly A tail were used to detect integration site of GSR cell line. Lane 17 was considered the most likely result of Alu PCR. No results identified on the other two types of cell lines (data not shown). (d) Integration site of GSR. Gene was inserted in intron between exon 5 and 6 of tetratricopeptide repeat protein 7a (Ttc7a) gene of chromosome 5. Black one-head arrows indicate primers for Alu PCR.

본 연구에서는 SINE의 앞 혹은 뒤에 외래유전자가 존재하는 각 두 가지 가정에 기반하여 실험을 진행하였으며 그 결과 전체 세 종류의 세포주 중 두 종류의 세포주에 삽입된 외래유전자의 위치를 파악하고 염기서열을 확인하였다. Alb-EPO의 경우 CMV promoter와 clone 49c를 활용한 결과에서 제어군과 차이를 보이는 band가 관찰되어 분석을 진행하였으나 CMV promoter의 짧은 단편만이 확인되어 target product가 삽입된 것이 아니라는 사실을 검증하였다. Alb-EPO에서 확인한 삽입위치 분석 실패의 주요 원인은 삽입된 위치 주위에 본 연구에 활용된 세 가지 SINE 중 어떠한 종류도 존재하지 않았기 때문으로 추정된다. 또한, Alu PCR 증폭 결과에서 전체 유전자 서열은 증폭되지 않고 일부 promoter fragment만 증폭되어 염기서열이 확인된 것으로 볼 때, Alb-EPO 세포주 개발 과정 중 수행된 외래유전자 증폭 과정에서 유전자의 일부 fragment가 생성되어 SINE 반복 서열 주위에 삽입되고, 이것이 Alu PCR에 의해 증폭된 것으로 사료된다. 이 결과는 Alu PCR 기법이 현재 가지고 있는 한계점을 나타내며, 이러한 한계점을 극복하기 위해 (1) 본 연구에서 사용된 3종 이외에 다양한 SINE 반복 서열의 확보 및 사용, (2) real time PCR을 접목하여 외래유전자의 copy 수를 특정하고 외래유전자 내에 추가적인 primer를 설계하여 multi-copy로 삽입된 외래 유전자의 증폭 등의 전략을 추구해야 할 것이다.

바이오의약품 생산에 CHO 세포주가 널리 사용되면서 MCB제조 이후의 세포주 검증의 중요성도 강조되어 왔다. 이에 따라 전체 세포주 개발 과정에서 clone 선별 과정, MCB의 characterization 및 clonality 검증 기간 및 비용을 절감하기 위한 다양한 시도가 진행되고 있다. 본 연구에서는 외래유전자의 삽입위치를 규명하여 세포주의 clonality를 검증하는 PCR 기반의 기술인 Alu PCR을 CHO 세포에 최적화함으로써 재조합 CHO 세포주 개발의 기간을 단축하고자 하였다. 이번 연구를 통해 재조합단백질을 생산하는 CHO 세포주에 Alu PCR을 적용하고 삽입위치를 규명함으로써 Alu PCR이 FISH 및 NGS 기반의 분석법과 동등한 성능평가법으로 활용될 수 있는 잠재성을 확인하였으며, 추후 저렴한 비용으로 세포주의 유전적 특성을 검증하는 분석도구로 대체할 수 있을 것으로 기대된다.

이 논문은 2020년도 인하대학교의 지원 및 2019, 2020년도 정부 (과학기술정보통신부)의 재원으로 한국연구재단의 지원을 받아 수행된 연구임(No. NRF-2019R1G1A1100213, NRF-2020R1C1C1006056)

  1. Grilo, A. L. and A. Mantalaris (2019) The Increasingly Human and Profitable Monoclonal Antibody Market. Trends Biotechnol. 37: 9-16.
    Pubmed CrossRef
  2. Noh, S. M., M. Sathyamurthy, and G.M. Lee (2013) Development of recombinant Chinese hamster ovary cell lines for therapeutic protein production. Curr. Opin. Chem. Eng. 2: 391-397.
    CrossRef
  3. Kaplon, H. and J. M. Reichert (2021) Antibodies to watch in 2021. MAbs 13: 1860476.
    Pubmed KoreaMed CrossRef
  4. U.S. Food and Drug Administration Center for Biologics Evaluation and Research (1997) Points to consider in the manufacture and testing of monoclonal antibody products for human use (1997). J. Immunother. 20: 214-243.
    Pubmed CrossRef
  5. Haynes, S. R., T. P. Toomey, L. Leinwand, and W. R. Jelinek (1981) The Chinese hamster Alu-equivalent sequence: a con-served highly repetitious, interspersed deoxyribonucleic acid sequence in mammals has a structure suggestive of a transposable element. Mol. Cell. Biol. 1: 573-583.
    Pubmed KoreaMed CrossRef
  6. Krayev, A. S., D. A. Kramerov, K. G. Skryabin, A. P. Ryskov, A. A. Bayev, and G. P. Georgiev (1980) The nucleotide sequence of the ubiquitous repetitive DNA sequence B1 complementary to the most abundant class of mouse fold-back RNA. Nucleic Acids Res. 8: 1201-1215.
    Pubmed KoreaMed CrossRef
  7. Miles, C. and M. Meuth (1989) G-repeats: a novel hamster sine family. Nucleic Acids Res. 17: 7221-7228.
    Pubmed KoreaMed CrossRef
  8. Deininger, P. L. and M. A. Batzer (2002) Mammalian retroelements. Genome Res. 12: 1455-1465.
    Pubmed CrossRef
  9. Minami, M., K. Poussin, C. Bréchot, and P. Paterlini (1995) A novel PCR technique using Alu-specific primers to identify unknown flanking sequences from the human genome. Genomics. 29: 403-408.
    Pubmed CrossRef

Stats or Metrics

Share this article on :

Related articles in KSBB